Skip to main content
Download PDF

Overcoming multiple drug resistance mechanisms in medulloblastoma

Acta Neuropathologica Communications volume 2, Article number: 57 (2014) Cite this article

Abstract

Introduction

Medulloblastoma (MB) is the most common malignant paediatric brain tumour. Recurrence and progression of disease occurs in 15-20% of standard risk and 30-40% of high risk patients. We analysed whether circumvention of chemoresistance pathways (drug export, DNA repair and apoptotic inhibition) can restore chemotherapeutic efficacy in a panel of MB cell lines.

Results

We demonstrate, by immunohistochemistry in patient tissue microarrays, that ABCB1 is expressed in 43% of tumours and is significantly associated with high-risk. We show that ABCB1, O6-methylguanine-DNA-methyltransferase (MGMT) and BCL2 family members are differentially expressed (by quantitative reverse transcription polymerase chain reaction, Western blotting and flow cytometry) in MB cell lines. Based on these findings, each pathway was then inhibited or circumvented and cell survival assessed using clonogenic assays. Inhibition of ABCB1 using vardenafil or verapamil resulted in a significant increase in sensitivity to etoposide in ABCB1-expressing MB cell lines. Sensitivity to temozolomide (TMZ) was MGMT-dependent, but two novel imidazotetrazine derivatives (N-3 sulfoxide and N-3 propargyl TMZ analogues) demonstrated ≥7 fold and ≥3 fold more potent cytotoxicity respectively compared to TMZ in MGMT-expressing MB cell lines. Activity of the BAD mimetic ABT-737 was BCL2A1 and ABCB1 dependent, whereas the pan-BCL2 inhibitor obatoclax was effective as a single cytotoxic agent irrespective of MCL1, BCL2, BCL2A1, or ABCB1 expression.

Conclusions

ABCB1 is associated with high-risk MB; hence, inhibition of ABCB1 by vardenafil may represent a valid approach in these patients. Imidazotetrazine analogues of TMZ and the BH3 mimetic obatoclax are promising clinical candidates in drug resistant MB tumours expressing MGMT and BCL2 anti-apoptotic members respectively.

Introduction

Medulloblastoma (MB) is the most frequent primary malignant brain tumour in children [1]. Currently the MB clinical staging system differentiates between standard-risk or high-risk disease depending on clinical findings and histologic subtype [2, 3]. Standard risk describes children older than 3 years of age at diagnosis with totally or near totally resected, non-disseminated disease and classic or desmoplastic histology. High-risk patients have either disseminated disease, incomplete resection or are of the large cell or anaplastic histologic subtypes [4, 5]. Treatment generally consists of gross total surgical excision combined with radiotherapy and chemotherapy; however 30-40% of high risk and 15-20% of standard risk patients develop recurrence of disease resulting in poor survival outcome [1, 3, 6–12]. Long term survivors suffer from treatment-associated endocrine, neurological, growth and neurocognitive complications that affect quality of life, in addition to having a substantial risk of secondary malignancy [13, 14]. From a chemotherapy perspective, primary MBs are mainly treated with combination chemotherapies that include: etoposide, methotrexate, cisplatin, lomustine, cyclophosphamide and vincristine [11, 15–17]. Recurrent and progressive tumours in children are treated with more intensive regimes frequently involving temozolomide (TMZ) and irinotecan although the prognosis for these patients is poor [1, 18–22].

Chemotherapy is now widely accepted as part of standard therapy for MB. The high frequency of recurrence, however, supports the hypothesis that a substantial number of patients have intrinsically drug resistant tumours [23]. Chemotherapy treatment failure is particularly relevant in children under three years of age who are preferentially treated with chemotherapy alone to minimise the adverse effect of radiotherapy on the developing brain [16, 24–26].

Classical multidrug resistance is often partly attributed to elevated expression of polyspecific ATP-dependent drug efflux pumps belonging to the ATP-binding cassette (ABC) transporter super family. The three best characterised are ABCB1 (also known as P-glycoprotein or MDR1), ABCG2 (Breast Cancer Resistance Protein) and ABCC1(multidrug resistance associated-protein 1 or MRP1) reviewed by Szakács et al.[27]. High expression of ABCB1 has previously been associated with chemoresistance and poor outcome in brain tumours including MB [28], glioma [29] and ependymoma (manuscript in preparation). We have also previously demonstrated that ABCB1 is expressed in a small subset of brain tumour cells and hypothesised that these cells are selected by current treatments resulting in relapse [30]. Since four of the drugs currently being used to treat primary and recurrent MB are ABCB1 substrates (etoposide, vincristine, methotrexate and irinotecan) [27] we would anticipate that overcoming/inhibiting ABCB1 could enhance the efficacy of current chemotherapy regimens.

Lomustine and TMZ are oral DNA alkylating cytotoxic drugs used for the treatment of primary and recurrent MB, respectively. The activity of both drugs depends on the absence of direct repair by O6-methylguanine-DNA-methyltransferase (MGMT) and proficient mismatch repair (MMR) [31]. Thus, over-expression of MGMT, a feature of more than half of MB patients in two recent studies [32, 33] can diminish the therapeutic efficacy of TMZ and lomustine. However, methylation of O6-guanine, the major cytotoxic lesion, comprises only 6% TMZ-DNA adducts [34], TMZ also methylates N7-guanine and N3- adenine, generating lesions which are repaired by base excision repair (BER) facilitated by the enzyme poly ADP ribose polymerase (PARP). Inhibition of PARP has been shown to enhance TMZ activity in vitro and in vivo[35, 36]. Recently, an alternative single agent approach has been shown to circumvent MGMT-mediated resistance in glioblastoma cell lines using novel imidazotetrazine TMZ analogues [37]. We wished to examine whether these agents were also able to effectively kill MB cells expressing high levels of MGMT.

Chemotherapy-induced cell cytotoxicity mainly occurs via the mitochondrial apoptotic pathway, regulated by the B-Cell lymphoma/leukaemia 2 (BCL2) family. Over-expression of anti-apoptotic BCL2 family proteins, such as BCL2, BCL-XL, MCL1 and BCL2A1, has been observed in many types of cancer including MB [38–41]. Hence, since the cloning of BCL2 25 years ago [42] many attempts have been made to target these pro-survival oncogenes therapeutically [43]. The most successful approach to target this pathway has been through the use of BCL2 homology 3 (BH3) mimetics; small molecules designed to mimic the BH3 domain found in pro-apoptotic members of the BCL-2 family. Recently two such small molecule inhibitors (ABT-737/ABT-263 and obatoclax) have entered clinical trial [44, 45]. We have previously tested ABT-737 on MB cell lines in vitro and although it was able to potentiate the action of cisplatin and etoposide, it proved ineffective as a single agent [46]. ABT-737 is described as a BAD mimetic since it shows the same binding to BCL2, BCL-XL and BCL-w as this BH3 pro-apoptotic protein. We needed to determine whether the lack of ABT-737 efficacy as a single agent was due to the expression of additional BCL2 family members, targetable by the pan-inhibitor obatoclax, or the fact that ABT-737 has recently been demonstrated to be an ABCB1 substrate in chronic lymphocytic leukaemia [47].

In this study we set out to investigate three potential reasons for chemotherapy failure in MB using a combination of patient tissue microarrays and early passage cell lines. We show that whilst all three mechanisms do indeed contribute to MB chemoresistance, each of them can be effectively circumvented using a combination of novel agents (vardenafil, N3-propargyl and obatoclax).

Materials and methods

Patient characteristics

Clinical and histological data for the Nottingham retrospective cohort are outlined in the Additional file 1: Table S1. Clinical details of patients included in tissue microarrays (TMA) obtained from German Cancer Research Centre DKFZ were previously published by Dubuc et al. [48].

Cell culture

Five new primary and recurrent (R) MB cell lines were derived as previously described [30] at the Children’s Brain Tumour Research Centre (CBTRC) (MED3, MED4, MED4R, MED5R and MED6) with approval from Local Research Ethics Committee. The tumours of origin were classified into molecular subtypes according to recent classification of MB subtypes [49–51]. Primary MB cell lines were cultured as monolayers and neurospheres as described previously [30]. The DAOY MB cell line was purchased from ATCC and cultured as recommended. UW228-3 was supplied by John R. Silber and grown as recommended [52]. A control Human Embryonic Kidney cell line (HEK-B1) stably expressing ABCB1 was provided as a gift by Rob Robey and cultured in DMEM with 10% serum and 500 μg/ml of G418.

Immunohistochemistry

Immunohistochemistry (IHC) was performed using the Dako Envision Detection kit (DAKO REAL EnVision) [53]. Sections were counter-stained with haematoxylin (Leica Microsystems). As negative controls, adjacent or similar sections were processed with antibody diluent (Dako). The antibodies (Abs) used to stain the original patient samples with appropriate control for each Ab are summarised in Additional file 2: Table S2.

A total of 27 Nottingham MB patients diagnosed between January 1986 and January 2006 were analysed by IHC. Consent for tumour tissue use was taken in accordance with national tumour banking procedures (UK: 05/MRE/04/70). A second TMA comprising 233 patient samples was obtained from the DKFZ [48]. Both TMAs were stained with the anti-ABCB1 Ab (C219, 1:40; Calbiochem) and patients with clear evidence of cell membrane staining were scored as positive by three independent reviewers who were blinded to clinical and patient molecular variables.

Detection of ABCB1 expression and inhibition of ABCB1 function by flow cytometry

To detect the percentage of ABCB1 expressing cells, 300,000-500,000 cells were incubated with 4E3 (anti-ABCB1; 1:20; Abcam) for 30 minutes at 37°C in fluorescent activated cell sorting (FACS) buffer (high glucose DMEM plus 5% BSA). The cells were then washed twice with FACS buffer and incubated with Alexa Fluor® 647 goat anti-mouse IgG (1: 1000; Invitrogen) for 30 minutes on ice in the dark. As a control, cells were stained with secondary Ab alone (Alexa Fluor 647; Invitrogen). Any unbound Ab was removed by washing the labelled cells twice with FACS buffer. To investigate ABCB1 function, cells were incubated with Rhodamine 123 (Rh123, Sigma; ABCB1 flourescent substrate), with and without ABCB1 inhibitors verapamil (VPL, Sigma), and vardenafil (TRC-Canada) at concentrations given in figure legends. Fluorescence was detected on a Cytomics FC500 flow cytometer (Beckman Coulter) and analysed using WinMDI version 2.8. Data presented are mean ± SEM of three independent experiments.

Quantitative polymerase chain reaction

RNA extraction from cultured cells was performed using mir Vana miRNA Isolation kit (Ambion) and transcribed into cDNA using reverse transcriptase (Superscript III; Invitrogen). The resulting cDNA template was amplified and sequenced using primers previously published by Kumar et al.[54]. PCR products were sequenced on the forward and reverse strands at the DNA sequencing lab at the University of Nottingham.

Quantitative reverse transcription PCR (QRT-PCR) analysis was carried out using the CFX96 real time PCR machine (BIO-RAD) and iQ SYBR Green SuperMix (BIO-RAD) to assess the expression. Primers for MB molecular subtyping (WIF1, SFRP1, NPR3 and KCNA1) were designed and published by Zhao et al.[55]. ABCB1 primers were as published by Valera et al.[56]. The house-keeping gene GAPDH (Forward primer 5′ ATGTTCGTCATGGGTGTGAA 3′; reverse primer 5′GTCTTCTGGGTGGCAGTGAT 3′) was used as a control to normalise the data, as the cycle threshold value for GAPDH expression was consistent across the sample set. Relative values of transcripts were calculated using the Pfaffl equation [57]. Results are presented as mean ± SEM of three independent experiments, each experiment was performed in triplicate.

To identify MYCC and MYCN copy number elevation in MB samples, genomic DNA extraction from frozen cell pellets was performed as previously described [30]. Quantitative PCR (QPCR) analysis was carried out using the CFX96 real time PCR machine (BIO-RAD) and iQ SYBR Green SuperMix (BIO-RAD). DNA isolated from D458 cells was used as a positive control for MYCC and a previously described sample of anaplastic astrocytoma with MYCN amplification was used as a positive control for MYCN [58]. MYCC and MYCN copy numbers were measured relative to the endogenous control RPLP0 and results for each sample were normalised to the copy number of diploid human DNA in Pfaffl equation [57]. Primer sequences have been previously published by Ryan et al. [59].

Western blotting

SDS PAGE and Western blotting were performed as previously described [46]. Blots were probed with the following Abs: mouse anti-ABCB1 (anti-C219 mouse monoclonal Ab; Calbiochem1:100), anti-MGMT (Millipore 1:100), rabbit anti-BCL2 (Cell Signaling clone 50E3 1:1000), rabbit anti BCL2A1 (Cell Signaling 1:1000), Rabbit anti-MCL1 (Santa Cruz 1:500) and either mouse anti-GAPDH (Sigma) or rabbit anti-β-tubulin (Cell Signalling Technology) 1:1000 as loading controls. All primary Abs were detected using goat anti-mouse/rabbit IgG HRP-linked secondary Ab (Cell Signalling Technology 1:2000) and enhanced chemoluminescence (GE Health Care Life Science) performed according to the manufacturer’s protocol.

Clonogenic assay

Cell growth inhibition was estimated after treatment of single cells in 6 well plates. Cells (150–200) were seeded into 6 well plates, and allowed to adhere (4–8 hours) before drug treatment. At the outset the clonogenic range was established for each drug and used to derive IC50 drug concentrations. The range of drug concentrations tested and the length of the treatment period was dependent on the drug being tested. Cells were incubated with: 0–8 μM etoposide (Sigma) for 2 hours; 0–50 μM ABT-737 (Benzamide; Selleckchem) for 24 hours; 0–3 μM obatoclax mesylate (GX15-070; Geminx) for 24 hours; 0–800 μM (MGMT+) or 0–100 μM (MGMT-) TMZ for 2 hours; and up to 200 μM N-3 sulfoxide and N-3 propargyl for 2 hours. Inhibitors were added for the same length of time as the drug, either in the same well or separately to assess toxicity. For experiments to investigate the role of ABCB1 in mediating drug resistance; verapamil (10, 20 μM Sigma) and vardenafil (5, 10 μM Toronto Research Chemicals) were tested. To investigate potentiation of TMZ or N3-propargyl by circumvention of BER the PARP inhibitor rucaparib (0.4 μM AG 014699; Selleckchem) was tested. Following drug +/− inhibitor addition, the cultures were then maintained at 37°C in a humidified atmosphere containing 5% v/v CO2, and allowed to grow for 6 (MED1), 7 (DAOY and UW228-3), or 12 (MED3) days depending on the cell line’s doubling time. Colonies were fixed with 4% w/v paraformaldehyde and stained with 0.1% w/v crystal violet (Sigma). Colonies that contained more than 50 cells (≥6 doublings) were counted. The colonies were double-scored (one of the scorers being blind to the culture conditions). Clonogenic assays were repeated at least three times as independent experiments, each with internal duplicate cultures. The percentage of clonogenic survival was expressed relative to vehicle controls.

Statistical analysis

Log-rank analysis on Kaplan–Meier curves determined the significance of overall survival (OS) and progression free survival (PFS) using SPSS version 21 statistical software (IBM). Differences between pairs of groups were determined by the Student’s t-test or Chi-squared test using GraphPad prism version 5.00 (San Diego California, USA) or IBM SPSS version 21 respectively. Response to TMZ and TMZ analogues between groups was assessed using one way ANOVA. P values < 0.05 were considered significant.

Results

ABCB1 expression is associated with high risk MB

There is evidence supporting a role for MGMT and the BCL2 family in MB chemotherapeutic response; however, the evidence supporting ABCB1 was more equivocal [28, 33, 41]. We therefore set out to identify whether there were clinical correlates of ABCB1 expression in a retrospective Nottingham MB patient TMA. In total 12 of 27 samples (44%) were positive for ABCB1 expression, and the majority of these were high risk patients, but this relationship was not statistically significant (P ≥ 0.05), presumably due to the small number of patient samples. We then analysed ABCB1 expression across a larger German DKFZ TMA. On this array 42% (99/233) of samples were positive for ABCB1 expression and ABCB1 was significantly more likely (P = 0.035) to be expressed in samples from high risk patients (Figure 1A). There was no significant difference between age, gender, resection status, and recurrence group of the two studies (P > 0.05, Additional file 3: Table S3). In each case positive samples contained a subpopulation of cells with membranous ABCB1 expression (0.1-11%). This high frequency of ABCB1 expression in MB patients and association with high risk clearly justified its inclusion in our chemoresistance analyses of patient derived cell lines.

Figure 1
figure 1

ABCB1 expression and functional analysis. (A) Membranous ABCB1 expression was scored across the DKFZ TMA and correlated with treatment risk group in 188 patients >3-17 years old. ABCB1 was significantly more likely (P ≤ 0.035) to be expressed in samples from high risk patients. (B) Relative expression of ABCB1 was calculated for each cell line using MED3 as a calibrator and GAPDH as a house keeping gene in the Pfaffl equation [57]. ABCB1 is expressed in 6/8 MB cell lines. Data are expressed as the mean ± SEM of three experiments, each performed in triplicate. (C) Flow cytometry analysis of ABCB1 cell surface expression was carried out on MED1, MED3, DAOY and HEK-B1 control cell lines stained with anti-ABCB1 antibody (clone 4E3; unfilled histogram) or secondary antibody alone (filled histogram). Although only 5.8% of MED1 cells are positive for ABCB1 some cells expressed very high levels whereas MED3 showed no expression of ABCB1 (0.6 ± 0.4%). Representative dotplots can be found in Additional file 11: Figure S7. (D, E) ABCB1 function was tested by flow cytometry. Cells were incubated with either Rh123 alone (filled histogram) or in combination with VPL (D) or vardenafil (E) shown as unfilled histograms in each case. Inhibition of ABCB1 function was observed in 3.5% of MED1 cells consistent with the low% of cells expressing ABCB1. Similarly, there was no inhibition of function in MED3 cell line. Results in (C-E) represent mean ± SEM of three independent experiments.

Full size image

Characterisation of MB cell lines and their tumour of origin

To investigate the mechanisms of drug resistance in MB, we have adopted an approach that involves establishing cell lines from patients’ primary and recurrent tumours [30]. In the current work, we describe 6 newly derived MB cell lines (including the previously described MED1) [30]. The clinical characteristics of these patients are presented in supplementary Additional file 4: Table S4. The tumours from which the cell lines were derived have been assigned to MB molecular subtypes [60, 61] using IHC for β-catenin, Gli1, NPR3 and KCNA1 (Additional file 5: Figure S1), and sequencing of the β-catenin gene (CTNNB1). The corresponding cell lines were sub-grouped by comparing expression of representative genes [WIF1 (WNT), SFRP (SHH), NPR3 (Group 3), and KCNA1 (Group 4)] to foetal cerebellum (Additional file 6: Figure S2, [55]). MYCC and MYCN copy number were determined (Additional file 7: Figure S3) and β-catenin sub-grouping was again confirmed by sequencing CTNNB1 (Additional file 8: Figure S4). These data are summarised in Table 1. Our data therefore suggest that MED1 is derived from a large cell anaplastic Group 4 tumour with MYCN amplification. MED3 is derived from a classical Group 3 tumour, MED4, and MED4R result from Group 3 tumours with MYCN gain. In each case the cell lines maintain the characteristics of their tumour of origin. MED5R and MED6 are derived from WNT subtypes (β-catenin positive) large cell anaplastic and classical tumours respectively. MED5R and MED6 have heterozygous mutations (TCT-TTT) at codons 33 and 37 (of CTNNB1) respectively. The MED5R cell line maintained the mutation in culture whereas the MED6 cell line reverted to wild type (Additional file 8: Figure S4). We also established that UW228-3 cells are NPR3 positive with MYCC gain. DAOY cells, on the other hand proved difficult to classify, although, have been classified recently as SHH by Pambid et al.[62].

Table 1 Characterisation of MB original patient samples and their derived cell lines
Full size table

ABCB1 expression and function is maintained in MB cell lines

ABCB1 expression was assessed in each of the tumours of origin by IHC (Additional file 9: Figure S5). The percentage of ABCB1 expressing cells ranged from ~1% in the MED6 to 11.2% in the MED1 tumour of origin (Table 1). ABCB1 expression was then assessed in the 6 CBTRC cell lines derived from these MBs as well as two more generally studied MB cell lines, DAOY and UW228-3, by QRT-PCR (Figure 1B). In common with the tumour of origin, MED1 cells expressed the highest levels of ABCB1 mRNA (Figure 1B) and glycosylated ABCB1 protein (Additional file 10: Figure S6), thus confirming maintenance of ABCB1 expression in culture. MED4, MED4R and MED5R demonstrated intermediate ABCB1 expression whereas MED3 cells expressed negligible mRNA and protein, again correlating with protein expression levels in primary tumours (Figure 1B, Additional file 10: Figure S6, Table 1). DAOY cells showed intermediate ABCB1 expression, whereas UW228-3 cells expressed low ABCB1 mRNA and protein levels. Three cell lines demonstrating high (MED1), intermediate (DAOY) and low (MED3) ABCB1 expression were further investigated for cell surface expression and function of ABCB1 by flow cytometry and compared to HEK-B1 cells stably expressing ABCB1 (Figure 1C-E). For MED1 5.8 ± 1.2% cells were positive for ABCB1 with some cells showing very high expression (Figure 1C, Additional file 11: Figure S7). MED3 cells demonstrated negligible ABCB1 expression (0.6 ± 0.4%). Within the DAOY cell population 2.4 ± 0.5% cells expressed consistently low ABCB1 levels (See Figure 1C, Additional file 11: Figure S7). ABCB1 function was investigated with the Rh123 extrusion assay. Extrusion of Rh123 in MED1 was inhibited by 20 μM VPL (right shifted cell histogram) and 10 μM vardenafil (Figure 1D,E) in ~3.5% of cells. Thus both agents are able to inhibit Rh123 extrusion in 60% of ABCB1 expressing (3.5/5.8) cells. Similar levels of inhibition (54-66%) were observed with both inhibitors in HEK-B1 and DAOY cells. MED3 cells failed to extrude Rh123 consistent with lack of ABCB1 cell surface expression.

Co-treatment with ABCB1 inhibitors VPL and vardenafil results in increased etoposide cytotoxicity

To further investigate ABCB1 function in vitro, clonogenic survival was assessed in ABCB1 negative MED3 and 2 ABCB1 positive (MED1 and DAOY) MB cell lines in response to etoposide alone or in combination with the ABCB1 inhibitors VPL and vardenafil. The IC50 concentrations for etoposide reflected the expression levels of ABCB1, with MED1 demonstrating the greatest degree of resistance to etoposide (MED1 1.92 μM, DAOY 1 μM, and MED3 0.5 μM) (Figure 2). Both ABCB1-expressing cell lines demonstrated significantly increased etoposide sensitivity when cells were treated with etoposide at the IC50 concentration plus inhibitors VPL or vardenafil compared to cells treated with etoposide alone (MED1 P < 0.0001 in all cases, Figure 2A; DAOY P < 0.001 in all cases except 5 μM vardenafil P = 0.02; Figure 2B). Conversely, no significant potentiation of cell cytotoxicity was observed when MED3 cells were treated with etoposide plus ABCB1 inhibitors (P > 0.05; Figure 2C). These results confirm that etoposide cytotoxicity in MB cell lines is significantly influenced by ABCB1 expression. Moreover, our in vitro assays confirm that vardenafil significantly inhibits ABCB1.

Figure 2
figure 2

Clonogenic survival analysis of MB cells treated with etoposide in the presence of ABCB1 inhibitors. The left panel shows the effect of increasing etoposide concentrations on clonogenic survival (100% representing solvent control). The middle and right panels represent clonogenic survival in the presence of etoposide (IC50 concentrations derived from dose–response data) in combination with VPL (10 and 20 μM) or vardenafil (5 and 10 μM) respectively. (A) MED1 clonogenic survival is significantly inhibited in cells co-treated with etoposide and VPL or vardenafil (unpaired student’s t-test, ٭٭٭P < 0.0001 in all cases). (B) There was also a significant increase in etoposide cytotoxicity in DAOY cells when combined with VPL and vardenafil (unpaired student’s t-test, ٭٭P < 0.001; ٭P = 0.02). (C) No significant inhibition was observed in the MED3 cell line. Data represent mean ± SEM of n ≥ 3 experiments, each experiment was performed in duplicate.

Full size image

Obatoclax-induced apoptosis in MB cell lines is independent of MCL1, BCL2A1 and ABCB1 expression

We have previously shown that MB cell lines express MCL1 and BCL2 anti-apoptotic proteins, and that the BH3 mimetic ABT-737, although able to potentiate activity of chemotherapeutic drugs, failed to induce apoptosis as a single agent in MB cell lines [46]. The lack of efficacy of ABT-737 could not be explained by BCL2 and MCL1 expression alone. Therefore we sought to further investigate the efficacy of ABT-737 against MB cell lines and compare it to the new anti-BCL2 drug obatoclax. We first looked at anti-apoptotic (BCL2, MCL1 and BCL2A1) protein expression in three representative MB cell lines, including UW228-3 since this was used in our previous study (Figure 3A). Whereas BCL2 and MCL1 were differentially expressed, consistent with our previous report [46], all 3 cell lines expressed BCL2A1. Previous studies on leukaemia cell lines have shown that ABT-737 is a substrate for ABCB1 [47], therefore the pro-apoptotic activity of ABT-737 and obatoclax were tested on these 3 cell lines with and without the ABCB1 inhibitor VPL (Figure 3B, C). ABT-737 was tested up to maximum 50 μM concentration (DMSO > 0.1%) but it was only able to reduce cell colony formation by approximately 20%, 15% and 20% in DAOY, MED1 and UW228-3 respectively. There was a small but significant increase in ABT-737 efficacy when ABCB1 positive MB cells were treated with ABT-737 (50 μM) plus 10 μM of VPL (P < 0.03 for MED1 and P < 0.02 for DAOY; Figure 3B) but no effect of VPL was found on ABCB1 negative UW228-3 cells (P ≥ 0.05). Obatoclax caused significantly decreased clonogenic cell survival resulting in less than 2% clonogenic survival at the highest concentration (3 μM) in all 3 cell lines (Figure 3C). The IC50 of obatoclax in DAOY, MED1 and UW228-3 was 0.27, 0.3 and 0.42 μM respectively. Most importantly, there was no significant change in colony formation following treatment of cells with obatoclax and VPL (P > 0.05; Figure 3C). Our in vitro results suggest that obatoclax is not an ABCB1 substrate; can inhibit BCL2, MCL1 and BCL2A1, and therefore, is more effective than ABT-737 since it can function as a single agent.

Figure 3
figure 3

BCL2 family protein expression and functional analysis. BCL2A1 and ABCB1 limit response to ABT-737 but not obatoclax. (A) DAOY, UW228-3 and MED1 cells were analysed by Western blotting for expression of anti-apoptotic BCL2 protein family member, BCL2 is expressed in DAOY and MED-1 whereas no expression was observed in UW228-3 cells. MCL1 is expressed in DAOY and UW228-3 whereas MED-1 displayed no expression. BCL2A1 was expressed at a low level in all three cell lines. β-tubulin served as a loading control. (B, C) Clonogenic survival of MB cells in the presence of ABT-737 (B) or obatoclax (C) alone (dotted line) or in combination with 10 μM VPL (solid lines). Although IC50 values were not reached, significant potentiation of ABT 737 function was observed at 50 μM concentration in combination with VPL in DAOY and MED1 cell lines (unpaired student’s t-test, ٭٭P = 0.03; ٭P = 0.02 respectively). Conversely, obatoclax IC50 values were in the nanomolar range for all 3 cell lines and there was no potentiation when combined with VPL. Results from B and C represent mean ± SEM of n ≥ 3 experiments, all performed in duplicate.

Full size image

Growth inhibition by the two novel TMZ analogues (N-3 sulfoxide and N-3 propargyl) is MGMT independent

TMZ cytotoxicity depends on the absence of MGMT enzyme and functioning MMR [31]. MGMT expression was assessed in all tumours of origin for our cell lines by IHC (Additional file 12: Figure S8, Table 1). Only MED1 was MGMT negative, with all other samples showing strong MGMT expression. DAOY, UW228-3 and MED3 MB cell lines all show high MGMT expression while MED1 cells show no MGMT expression by Western blotting, consistent with the observed expression in primary tissue samples from the corresponding tumours (Figure 4A, Additional file 12: Figure S8). The efficacy of TMZ and two novel imidazotetrazine TMZ analogues (N-3 sulfoxide and N-3 propargyl; Figure 4B) were compared using the clonogenic assay. Clonogenic survival was concentration-dependent in all 4 cell lines. DAOY, UW228-3 and MED3 were resistant to TMZ (IC50 = 290–540 μM; Figure 4C); in contrast MED1 cells were sensitive (IC50 = 31 μM; Figure 4C). All MB cell lines were sensitive to sulfoxide and propargyl analogues independent of MGMT expression (sulfoxide IC50 15–40 μM whereas propargyl IC50 42.4-96.3 μM; Figure 4C). To investigate whether BER was also able to modulate response we determined the IC50 concentrations for TMZ and the propargyl analogue when cells were treated in combination with the PARP inhibitor rucaparib (Additional file 13: Figure S9). There was considerable chemosensitisation of TMZ by rucaparib in MGMT expressing DAOY, MED3 and UW228-3 cell lines (1.9 fold P = 0.02, 2.7 fold P = 0.002 and 2.2 fold P = 0.029 respectively; Table 2, Additional file 13: Figure S9). There was however no potentiation of propargyl cytotoxicity in combination with rucaparib (Table 2, Additional file 13: Figure S9). These results suggest that in MB cells cytotoxicity induced by the N-3 propargyl analogue is independent of MGMT and BER.

Figure 4
figure 4

MGMT expression and response to TMZ, propargyl and sulfoxide imidazotetrazine analogues. (A) Relative levels of MGMT expression were determined by Western blotting. DAOY, UW228-3 and MED3 cells showed high expression of MGMT while no expression was observed in MED1 cells. (B) Chemical structure of TMZ, propargyl and sulfoxide, shows different N3 groups. (C) Clonogenic survival was determined as in Figures 2, and 3, the data represent the IC50 values (mean ± SEM, n ≥ 3) TMZ inhibited survival in an MGMT-status dependent manner (IC50 at 290–540 μM in MGMT positive cells (DAOY, UW228-3 and MED3) compared to 31 μM in MGMT negative MED1 cells). Propargyl and sulfoxide derivatives of TMZ inhibited survival at 40–80 and 20–40 μM respectively in all cell lines, showing no dependence on MGMT expression (unpaired student’s t-test, ٭٭٭P < 0.0001; ٭P < 0.05).

Full size image
Table 2 Toxicity and efficacy of TMZ and propargyl in combination with PARP inhibitor rucaparib in MB cell lines
Full size table

Discussion

Benefit of adjuvant chemotherapy has been demonstrated in children [10] particularly those under 3 years of age with desmoplastic MB [3, 9, 10, 15, 16, 25]. However, particularly in high risk disease and in children under 3 years of age with classic and anaplastic MB, chemotherapy failure due to drug resistance is a recognised limitation to cure. There are many aspects to chemotherapy resistance with protective mechanisms operating at each stage of the cytotoxic process. We have sought here to investigate three basic mechanisms that are key to effective chemotherapy cytotoxicity and resistance. Firstly, chemotherapeutic drugs must remain in the tumour cell long enough to damage DNA. Secondly, this damage must not be repaired. Thirdly, downstream apoptosis mechanisms must be active. By studying a set of MB cell lines we have demonstrated that all of these processes reducing cytotoxicity are active, but can be effectively inhibited or circumvented. Firstly, we have demonstrated that > 40% of MB tumours express the ABCB1 multi-drug transporter, which is able to export many of the currently used chemotherapeutic drugs. There was no difference in ABCB1 expression between the 4 molecular subtypes (data not shown). Importantly, our in vitro data shows that export by ABCB1 could be inhibited resulting in increased cytotoxicity. Secondly, we have shown that although MGMT is expressed in the majority of MB patients’ tumours, and is able to directly repair the effects of DNA alkylating agents it cannot repair the effects of two novel imidazotetrazine derivatives of TMZ (N-3 sulfoxide and N-3 propargyl) in MB cells. Thirdly, our data indicate that, despite the expression of several BCL2 anti-apoptotic family members, the BH3 mimetic obatoclax is effective as a single agent in MB.

Multidrug transporters serve as a major mechanism of defence in cancer chemotherapy. We hypothesise that the treatment of MB with current chemotherapeutic drugs, although effective as adjuvant therapy, leads to selection of an ABCB1 transporter expressing sub-populations of cells that in time can give rise to a more resistant tumour [63]. Importantly we have shown that in the DKFZ array ABCB1 expression is associated with patients that fall into the high risk category, which despite more aggressive therapy have a poorer outcome [2, 6, 7]. The concentration of etoposide used to achieve an IC50 in the ABCB1 positive MED1 cell line was slightly above the concentration used in clinic [64] while the MED3 IC50 was below the dose limiting toxicity. The data suggest however that the application of drugs that circumvent ABC transporters could therefore represent a valid addition to current MB chemotherapy regimens, particularly in high risk MB. We have used two inhibitors to overcome ABCB1 resistance in MB cells. VPL (a calcium channel blocker) is a nonspecific ABCB1 inhibitor and its low affinity to ABCB1 necessitated use of a high dose to block ABCB1 in clinical trials, resulting in unacceptable cardiac toxicity [65]. Vardenafil is a phosphodiesterase type 5 inhibitor used to treat children and infants with pulmonary arterial hypertension and portal hypertension with minimal adverse effects at concentrations above those indicated in our study [66, 67]. It has been previously shown that vardenafil can specifically block ABCB1 transporter function and enhance blood–brain and blood–brain tumour barrier permeability thereby enhancing delivery of herceptin to the brain in mice bearing intracranial breast and lung cancer [68, 69]. Our results showed that vardenafil enhances etoposide cytotoxicity in ABCB1-expressing MB cell lines. The activity of vardenafil in each of our assays was equivalent to that of the non-specific ABCB1 inhibitor verapamil. Thus, vardenafil is a good potential candidate for combination with current chemotherapeutics in patients with MB and should now be tested in vivo in pre-clinical models.

Many efforts have been made towards development of small molecules able to overcome the anti-apoptotic activity of anti-apoptotic BCL2 family proteins. ABT-737 can overcome BCL2 and BCL-XL and is currently in phase 1 clinical trial in small cell lung cancer (SCLC) and chronic lymphocytic leukaemia [45, 70]. Although effective as a single agent in SCLC and leukaemia, ABT-737 was not able to induce apoptosis as a single agent in MB cells [46, 71, 72]. It has been previously shown that ABT-737 function can be limited by BCL2A1 and MCL1 protein expression [73–75]. Additionally, ABT-737 has been demonstrated to be a substrate for ABCB1 and ABCC1 [47, 76]. Our data suggest that ABT-737 induction of apoptosis in MB is dependent of both BCL2A1 and ABCB1 protein expression. Using an ABCB1 inhibitor did significantly potentiate the activity of ABT-737 in MB cells; however the IC50 concentration was still not reached and these concentrations would result in significant toxicity in vivo[77, 78]. Obatoclax, on the other hand readily induced apoptosis, regardless of BCL2A1 and ABCB1 protein expression, at concentrations below the dose limiting toxicity concentration observed in phase 1 clinical trial [39]. Obatoclax has been used in a phase 1 clinical trial on advanced leukemic patients where it showed minimum toxicity and one patient had complete remission for 8 months [44]. We believe obatoclax is a better candidate than ABT-737 and may therefore represent a viable therapeutic option in MB patients.

TMZ and Lomustine are alkylating agents commonly used in clinic, however, the DNA damage cause by these drugs can be repaired by MGMT [31]. Notably only the IC50 concentration in the MGMT negative cell lines (MED1) was below the maximum tolerated dose of TMZ used in clinical trial [79]. Two novel imidazotetrazine analogues N-3 sulfoxide and N-3 propargyl TMZ derivatives used in this project were developed by Pharminox in order to overcome direct DNA repair by MGMT [31]. It is hypothesised that propargyl and sulfoxide analogues deliver cytotoxic lesions to O6-guanine which cannot be removed by MGMT and both analogues have been shown to cause double DNA strand breaks leading to death in glioma cells. Overcoming MGMT resistance in MB may be reliant on MB tumours being proficient in mismatch repair. This is potentially not an issue since MMR proficiency was recently demonstrated in 74/74 primary MB tumours in a study by von Bueren et al.[33]. In addition to MGMT repair of O6-methylguanine, TMZ methylation at N7-methylguanine and N3- methyladenine purines can also be repaired by PARP through BER. Our data demonstrate that sulfoxide and propargyl analogues are cytotoxic to all 4 MB cell lines regardless of MGMT expression and that, unlike TMZ, the efficacy of the propargyl analogue cannot be potentiated by the PARP inhibitor rucaparib. This suggests that putative propargyl modification at N3 and N7 positions may not be recognized by PARP, or cannot be repaired by BER. Stability studies of the 2 analogues have shown that N3-propargyl is more stable than TMZ in plasma (100 minutes versus 30 minutes respectively); however, the N3-sulfoxide analogue is extremely unstable in plasma and hence unsuitable as a clinical candidate. Hence, propargyl could be a good substitute for TMZ in recurrent and progressive MBs and may also be effective in primary tumours.

Conclusions

We have tested three mechanisms of resistance to chemotherapy mediated by ABCB1, MGMT and anti-apoptotic BCL2 family members in MB cell lines. Targeting these factors either by using an ABCB1inhibitor (vardenafil), a novel agent that can circumvent DNA repair (N3-propargyl analogue of TMZ) or a BH3 mimetic to inhibit BCL2 anti-apoptotic proteins (obatoclax) could all be viable therapeutic routes in this malignant tumour in children. Our study of a small subset of MB cell lines, however, indicates that these resistance mechanisms are not mutually exclusive. Hence, the next stage should not only be to test the efficacy of these agents in in vivo models but also to use them in combination. We believe that such an approach will help to redefine MB as a more chemo-sensitive disease.

Abbreviations

MB:

Medulloblastoma

MGMT:

O6-methylguanine-DNA-methyltransferase

TMZ:

Temozolomide

ABC:

ATP-binding cassette

ABCB1:

ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 1, P-glycoprotein or MDR1

MMR:

Mismatch repair

PARP:

Poly ADP ribose polymerase

BER:

Base excision repair

BCL2:

B-cell lymphoma/leukaemia 2

BH3:

BCL2 homology 3

HEK:

Human embryonic kidney cell line

IHC:

Immunohistochemistry

FACS:

Fluorescent activated cell sorting

Ab:

Antibody

Rh123:

Rhodamine 123

VPL:

Verapamil

SEM:

Standard error of the mean

QPCR:

Quantitative polymerase chain reaction

OS:

Overall survival

PFS:

Progression free survival

SDS PAGE:

Sodium dodecyl sulfate poly-acrylamide gel electrophoresis.

References

  1. Pizer BL, Clifford SC: The potential impact of tumour biology on improved clinical practice for medulloblastoma: progress towards biologically driven clinical trials. Br J Neurosurg 2009, 23(4):364–375. 10.1080/02688690903121807

    Article  PubMed  Google Scholar 

  2. Campen CJ, Dearlove J, Partap S, Murphy P, Gibbs IC, Dahl GV, Fisher PG: Concurrent cyclophosphamide and craniospinal radiotherapy for pediatric high-risk embryonal brain tumors. J Neurooncol 2012, 110(2):287–291. 10.1007/s11060-012-0969-2

    Article  CAS  PubMed  Google Scholar 

  3. Lannering B, Rutkowski S, Doz F, Pizer B, Gustafsson G, Navajas A, Massimino M, Reddingius R, Benesch M, Carrie C: Hyperfractionated Versus Conventional Radiotherapy Followed by Chemotherapy in Standard-Risk Medulloblastoma: Results From the Randomized Multicenter HIT-SIOP PNET 4 Trial. J Clin Oncol 2012, 30(26):3187–3193. 10.1200/JCO.2011.39.8719

    Article  PubMed  Google Scholar 

  4. Burger PC, Yu I, Tihan T, Friedman HS, Strother DR, Kepner JL, Duffner PK, Kun LE, Perlman EJ: Atypical teratoid/rhabdoid tumor of the central nervous system: a highly malignant tumor of infancy and childhood frequently mistaken for medulloblastoma: a Pediatric Oncology Group study. Am J Surg Pathol 1998, 22(9):1083–1092. 10.1097/00000478-199809000-00007

    Article  CAS  PubMed  Google Scholar 

  5. Gottardo NG, Gajjar A: Current therapy for medulloblastoma. Curr Treat Options Neurol 2006, 8(4):319–334. 10.1007/s11940-006-0022-x

    Article  PubMed  Google Scholar 

  6. Taylor RE, Bailey CC, Robinson KJ, Weston CL, Walker DA, Ellison D, Ironside J, Pizer BL, Lashford LS: Outcome for patients with metastatic (M2–3) medulloblastoma treated with SIOP/UKCCSG PNET-3 chemotherapy. Eur J Cancer (Oxford, England: 1990) 2005, 41(5):727–734. doi:10.1016/j.ejca.2004.12.017 10.1016/j.ejca.2004.12.017

    Article  CAS  Google Scholar 

  7. Zeltzer PM, Boyett JM, Finlay JL, Albright AL, Rorke LB, Milstein JM, Allen JC, Stevens KR, Stanley P, Li H: Metastasis stage, adjuvant treatment, and residual tumor are prognostic factors for medulloblastoma in children: conclusions from the Children’s Cancer Group 921 randomized phase III study. J Clin Oncol 1999, 17(3):832–832.

    CAS  PubMed  Google Scholar 

  8. Gandola L, Massimino M, Cefalo G, Solero C, Spreafico F, Pecori E, Riva D, Collini P, Pignoli E, Giangaspero F: Hyperfractionated accelerated radiotherapy in the Milan strategy for metastatic medulloblastoma. J Clin Oncol 2009, 27(4):566–571.

    Article  CAS  PubMed  Google Scholar 

  9. Packer RJ, Zhou T, Holmes E, Vezina G, Gajjar A: Survival and secondary tumors in children with medulloblastoma receiving radiotherapy and adjuvant chemotherapy: results of Children’s Oncology Group trial A9961. Neuro Oncol 2013, 15(1):97–103. 10.1093/neuonc/nos267

    Article  CAS  PubMed  Google Scholar 

  10. Taylor RE, Bailey CC, Robinson K, Weston CL, Ellison D, Ironside J, Lucraft H, Gilbertson R, Tait DM, Walker DA: Results of a randomized study of preradiation chemotherapy versus radiotherapy alone for nonmetastatic medulloblastoma: The International Society of Paediatric Oncology/United Kingdom Children’s Cancer Study Group PNET-3 Study. J Clin Oncol 2003, 21(8):1581–1591. 10.1200/JCO.2003.05.116

    Article  CAS  PubMed  Google Scholar 

  11. Kortmann RD, Kühl J, Timmermann B, Mittler U, Urban C, Budach V, Richter E, Willich N, Flentje M, Berthold F: Postoperative neoadjuvant chemotherapy before radiotherapy as compared to immediate radiotherapy followed by maintenance chemotherapy in the treatment of medulloblastoma in childhood: results of the German prospective randomized trial HIT’91. Int J Radiat Oncol Biol Phys 2000, 46(2):269–279. 10.1016/S0360-3016(99)00369-7

    Article  CAS  PubMed  Google Scholar 

  12. Tarbell NJ, Friedman H, Polkinghorn WR, Yock T, Zhou T, Chen Z, Burger P, Barnes P, Kun L: High-risk medulloblastoma: a Pediatric Oncology Group randomized trial of chemotherapy Before or after radiation therapy (POG 9031). J Clin Oncol 2013, 31(23):2936–2941. 10.1200/JCO.2012.43.9984

    Article  PubMed  PubMed Central  Google Scholar 

  13. Ribi K, Relly C, Landolt M, Alber F, Boltshauser E, Grotzer M: Outcome of medulloblastoma in children: long-term complications and quality of life. Neuropediatrics 2005, 36(6):357–365. 10.1055/s-2005-872880

    Article  CAS  PubMed  Google Scholar 

  14. Hoff K, Hinkes B, Gerber NU, Deinlein F, Mittler U, Urban C, Benesch M, Warmuth-Metz M, Soerensen N, Zwiener I: Long-term outcome and clinical prognostic factors in children with medulloblastoma treated in the prospective randomised multicentre trial HIT ‘91. Eur J Cancer 2009, 45(7):1209–1217. 10.1016/j.ejca.2009.01.015

    Article  Google Scholar 

  15. Packer RJ, Gajjar A, Vezina G, Rorke-Adams L, Burger PC, Robertson PL, Bayer L, LaFond D, Donahue BR, Marymont MAH: Phase III study of craniospinal radiation therapy followed by adjuvant chemotherapy for newly diagnosed average-risk medulloblastoma. J Clin Oncol 2006, 24(25):4202–4208. 10.1200/JCO.2006.06.4980

    Article  CAS  PubMed  Google Scholar 

  16. Grundy R, Wilne S, Robinson K, Ironside J, Cox T, Chong W, Michalski A, Campbell R, Bailey C, Thorp N: Primary postoperative chemotherapy without radiotherapy for treatment of brain tumours other than ependymoma in children under 3 years: results of the first UKCCSG/SIOP CNS 9204 trial. Eur J Cancer 2010, 46(1):120–133. 10.1016/j.ejca.2009.09.013

    Article  CAS  PubMed  Google Scholar 

  17. Pizer B, Clifford S: Medulloblastoma: new insights into biology and treatment. Arch Dis Child Educ Pract Ed 2008, 93(5):137–144. 10.1136/adc.2007.136655

    Article  CAS  PubMed  Google Scholar 

  18. Gajjar A, Chintagumpala M, Ashley D, Kellie S, Kun LE, Merchant TE, Woo S, Wheeler G, Ahern V, Krasin MJ: Risk-adapted craniospinal radiotherapy followed by high-dose chemotherapy and stem-cell rescue in children with newly diagnosed medulloblastoma (St Jude Medulloblastoma-96): long-term results from a prospective, multicentre trial. Lancet Oncol 2006, 7(10):813–820. 10.1016/S1470-2045(06)70867-1

    Article  PubMed  Google Scholar 

  19. Jakacki R, Burger P, Zhou T, Holmes E, Packer R, Goldwein J, Mehta M, Pollack I: Outcome for metastatic (M+) medulloblastoma (MB) treated with carboplatin during craniospinal radiotherapy (CSRT) followed by cyclophosphamide (CPM) and vincristine (VCR): Preliminary results of COG 99701. J Clin Oncol 2007, 25(18S):2017.

    Google Scholar 

  20. Aguilera D, Mazewski C, Fangusaro J, MacDonald TJ, McNall-Knapp RY, Hayes LL, Kim S, Castellino RC: Response to bevacizumab, irinotecan, and temozolomide in children with relapsed medulloblastoma: a multi-institutional experience. Childs Nerv Syst 2013, 29(4):589–596. doi:10.1007/s00381–012–2013–4 10.1007/s00381-012-2013-4

    Article  PubMed  PubMed Central  Google Scholar 

  21. Akyüz C, Demir HA, Varan A, Yalçın B, Kutluk T, Büyükpamukçu M: Temozolomide in relapsed pediatric brain tumors: 14 cases from a single center. Childs Nerv Syst 2012, 28(1):111–115. 10.1007/s00381-011-1561-3

    Article  PubMed  Google Scholar 

  22. Padovani L, Andre N, Gentet JC, Figarella Branger D, Scavarda D, Verschuur A, Chinot O, Cowen D, Muracciole X: Reirradiation and concomitant metronomic temozolomide: an efficient combination for local control in medulloblastoma disease? J Pediatr Hematol Oncol 2011, 33(8):600. 10.1097/MPH.0b013e3182331eaf

    Article  PubMed  Google Scholar 

  23. Johnsen JI, Kogner P, Albihn A, Henriksson MA: Embryonal neural tumours and cell death. Apoptosis 2009, 14(4):424–438. doi:10.1007/s10495–009–0325-y 10.1007/s10495-009-0325-y

    Article  PubMed  Google Scholar 

  24. Rutkowski S, Bode U, Deinlein F, Ottensmeier H, Warmuth-Metz M, Soerensen N, Graf N, Emser A, Pietsch T, Wolff JEA: Treatment of early childhood medulloblastoma by postoperative chemotherapy alone. N Engl J Med 2005, 352(10):978–986. 10.1056/NEJMoa042176

    Article  CAS  PubMed  Google Scholar 

  25. Grill J, Sainte-Rose C, Jouvet A, Gentet JC, Lejars O, Frappaz D, Doz F, Rialland X, Pichon F, Bertozzi AI: Treatment of medulloblastoma with postoperative chemotherapy alone: an SFOP prospective trial in young children. Lancet Oncol 2005, 6(8):573–580. 10.1016/S1470-2045(05)70252-7

    Article  CAS  PubMed  Google Scholar 

  26. Rutkowski S, Gerber NU, Von Hoff K, Gnekow A, Bode U, Graf N, Berthold F, Henze G, Wolff JEA, Warmuth-Metz M: Treatment of early childhood medulloblastoma by postoperative chemotherapy and deferred radiotherapy. Neuro Oncol 2009, 11(2):201–210.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Szakács G, Paterson JK, Ludwig JA, Booth-Genthe C, Gottesman MM: Targeting multidrug resistance in cancer. Nat Rev Drug Discov 2006, 5(3):219–234. 10.1038/nrd1984

    Article  PubMed  Google Scholar 

  28. Chou PM, Reyes-Mugica M, Barquin N, Yasuda T, Tan X, Tomita T: Multidrug resistance gene expression in childhood medulloblastoma: correlation with clinical outcome and DNA ploidy in 29 patients. Pediatr Neurosurg 1995, 23(6):283–292. 10.1159/000120984

    Article  CAS  PubMed  Google Scholar 

  29. von Bossanyi P, Diete S, Dietzmann K, Warich-Kirches M, Kirches E: Immunohistochemical expression of P-glycoprotein and glutathione S-transferases in cerebral gliomas and response to chemotherapy. Acta Neuropathol 1997, 94(6):605–611. 10.1007/s004010050756

    Article  CAS  PubMed  Google Scholar 

  30. Hussein D, Punjaruk W, Storer LCD, Shaw L, Ottoman R, Peet A, Miller S, Bandopadhyay G, Heath R, Kumari R: Pediatric brain tumor cancer stem cells: cell cycle dynamics, DNA repair, and etoposide extrusion. Neuro Oncol 2011, 13(1):70–83. 10.1093/neuonc/noq144

    Article  CAS  PubMed  Google Scholar 

  31. Zhang J, Stevens M, Bradshaw T: Temozolomide: mechanisms of action, repair and resistance. Curr Mol Pharmacol 2012, 5(1):102. 10.2174/1874467211205010102

    Article  CAS  PubMed  Google Scholar 

  32. Faoro D, von Bueren AO, Shalaby T, Sciuscio D, Hürlimann ML, Arnold L, Gerber NU, Haybaeck J, Mittelbronn M, Rutkowski S: Expression of O 6-methylguanine-DNA methyltransferase in childhood medulloblastoma. J Neurooncol 2011, 103(1):59–69. 10.1007/s11060-010-0366-7

    Article  CAS  PubMed  Google Scholar 

  33. von Bueren AO, Bacolod MD, Hagel C, Heinimann K, Fedier A, Kordes U, Pietsch T, Koster J, Grotzer MA, Friedman HS, Marra G, Kool M, Rutkowski S: Mismatch repair deficiency: a temozolomide resistance factor in medulloblastoma cell lines that is uncommon in primary medulloblastoma tumours. Br J Cancer 2012, 107(8):1399–1408. doi:10.1038/bjc.2012.403 10.1038/bjc.2012.403

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Tisdale MJ: Antitumour imidazotetrazines—XV: Role of guanine O6 alkylation in the mechanism of cytotoxicity of imidazotetrazinones. Biochem Pharmacol 1987, 36(4):457–462. 10.1016/0006-2952(87)90351-0

    Article  CAS  PubMed  Google Scholar 

  35. Daniel R, Rozanska A, Mulligan E, Drew Y, Thomas H, Castelbuono D, Hostomsky Z, Plummer E, Tweddle D, Boddy A: Central nervous system penetration and enhancement of temozolomide activity in childhood medulloblastoma models by poly (ADP-ribose) polymerase inhibitor AG-014699. Br J Cancer 2010, 103(10):1588–1596. 10.1038/sj.bjc.6605946

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Curtin NJ, Wang LZ, Yiakouvaki A, Kyle S, Arris CA, Canan-Koch S, Webber SE, Durkacz BW, Calvert HA, Hostomsky Z: Novel poly (ADP-ribose) polymerase-1 inhibitor, AG14361, restores sensitivity to temozolomide in mismatch repair-deficient cells. Clin Cancer Res 2004, 10(3):881–889. 10.1158/1078-0432.CCR-1144-3

    Article  CAS  PubMed  Google Scholar 

  37. Zhang J, Stevens MF, Hummersone M, Madhusudan S, Laughton CA, Bradshaw TD: Certain imidazotetrazines escape O6-methylguanine-DNA methyltransferase and mismatch repair. Oncology 2011, 80(3–4):195–207.

    Article  CAS  PubMed  Google Scholar 

  38. Vogler M, Dinsdale D, Dyer MJS, Cohen GM: Bcl-2 inhibitors: small molecules with a big impact on cancer therapy. Cell Death & Differentiation 2008, 16(3):360–367.

    Article  Google Scholar 

  39. Cragg MS, Harris C, Strasser A, Scott CL: Unleashing the power of inhibitors of oncogenic kinases through BH3 mimetics. Nat Rev Cancer 2009, 9(5):321–326. 10.1038/nrc2615

    Article  CAS  PubMed  Google Scholar 

  40. Huang S, Sinicrope FA: BH3 mimetic ABT-737 potentiates TRAIL-mediated apoptotic signaling by unsequestering Bim and Bak in human pancreatic cancer cells. Cancer Res 2008, 68(8):2944–2951. 10.1158/0008-5472.CAN-07-2508

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Schüller U, Schober F, Kretzschmar H, Herms J: Bcl‒2 expression inversely correlates with tumour cell differentiation in medulloblastoma. Neuropathol Appl Neurobiol 2004, 30(5):513–521. 10.1111/j.1365-2990.2004.00553.x

    Article  PubMed  Google Scholar 

  42. Pegoraro L, Palumbo A, Erikson J, Falda M, Giovanazzo B, Emanuel BS, Rovera G, Nowell PC, Croce CM: A 14; 18 and an 8; 14 chromosome translocation in a cell line derived from an acute B-cell leukemia. Proc Natl Acad Sci 1984, 81(22):7166–7170. 10.1073/pnas.81.22.7166

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Oltersdorf T, Elmore SW, Shoemaker AR, Armstrong RC, Augeri DJ, Belli BA, Bruncko M, Deckwerth TL, Dinges J, Hajduk PJ: An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature 2005, 435(7042):677–681. 10.1038/nature03579

    Article  CAS  PubMed  Google Scholar 

  44. Schimmer AD, O’Brien S, Kantarjian H, Brandwein J, Cheson BD, Minden MD, Yee K, Ravandi F, Giles F, Schuh A: A phase I study of the pan bcl-2 family inhibitor obatoclax mesylate in patients with advanced hematologic malignancies. Clin Cancer Res 2008, 14(24):8295–8301. 10.1158/1078-0432.CCR-08-0999

    Article  CAS  PubMed  Google Scholar 

  45. O’Brien SM, Claxton DF, Crump M, Faderl S, Kipps T, Keating MJ, Viallet J, Cheson BD: Phase I study of obatoclax mesylate (GX15–070), a small molecule pan–Bcl-2 family antagonist, in patients with advanced chronic lymphocytic leukemia. Blood 2009, 113(2):299–305.

    Article  PubMed  Google Scholar 

  46. Levesley J, Lusher ME, Lindsey JC, Clifford SC, Grundy R, Coyle B: RASSF1A and the BH3-only mimetic ABT-737 promote apoptosis in pediatric medulloblastoma cell lines. Neuro Oncol 2011, 13(12):1265–1276. 10.1093/neuonc/nor129

    Article  PubMed  PubMed Central  Google Scholar 

  47. Vogler M, Dickens D, Dyer MJS, Owen A, Pirmohamed M, Cohen GM: The B-cell lymphoma 2 (BCL2)-inhibitors, ABT-737 and ABT-263, are substrates for P-glycoprotein. Biochem Biophys Res Commun 2011, 408(2):344–349. 10.1016/j.bbrc.2011.04.043

    Article  CAS  PubMed  Google Scholar 

  48. Dubuc AM, Remke M, Korshunov A, Northcott PA, Zhan SH, Mendez-Lago M, Kool M, Jones DT, Unterberger A, Morrissy AS, Shih D, Peacock J, Ramaswamy V, Rolider A, Wang X, Witt H, Hielscher T, Hawkins C, Vibhakar R, Croul S, Rutka JT, Weiss WA, Jones SJ, Eberhart CG, Marra MA, Pfister SM, Taylor MD: Aberrant patterns of H3K4 and H3K27 histone lysine methylation occur across subgroups in medulloblastoma. Acta Neuropathol 2013, 125(3):373–384. doi:10.1007/s00401–012–1070–9 10.1007/s00401-012-1070-9

    Article  CAS  PubMed  Google Scholar 

  49. Kool M, Korshunov A, Remke M, Jones DT, Schlanstein M, Northcott PA, Cho YJ, Koster J, Schouten-van Meeteren A, van Vuurden D, Clifford SC, Pietsch T, von Bueren AO, Rutkowski S, McCabe M, Collins VP, Backlund ML, Haberler C, Bourdeaut F, Delattre O, Doz F, Ellison DW, Gilbertson RJ, Pomeroy SL, Taylor MD, Lichter P, Pfister SM: Molecular subgroups of medulloblastoma: an international meta-analysis of transcriptome, genetic aberrations, and clinical data of WNT, SHH, Group 3, and Group 4 medulloblastomas. Acta Neuropathol 2012, 123(4):473–484. doi:10.1007/s00401–012–0958–8 10.1007/s00401-012-0958-8

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Schwalbe EC, Lindsey JC, Straughton D, Hogg TL, Cole M, Megahed H, Ryan SL, Lusher ME, Taylor MD, Gilbertson RJ: Rapid diagnosis of medulloblastoma molecular subgroups. Clin Cancer Res 2011, 17(7):1883–1894. 10.1158/1078-0432.CCR-10-2210

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Ellison DW, Dalton J, Kocak M, Nicholson SL, Fraga C, Neale G, Kenney AM, Brat DJ, Perry A, Yong WH: Medulloblastoma: clinicopathological correlates of SHH, WNT, and non-SHH/WNT molecular subgroups. Acta Neuropathol 2011, 121(3):381–396. 10.1007/s00401-011-0800-8

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Keles GE, Berger MS, Srinivasan J, Kolstoe DD, Bobola MS, Silber JR: Establishment and characterization of four human medulloblastoma-derived cell lines. Oncol Res 1995, 7(10–11):493.

    CAS  PubMed  Google Scholar 

  53. Ridley L, Rahman R, Brundler MA, Ellison D, Lowe J, Robson K, Prebble E, Luckett I, Gilbertson RJ, Parkes S: Multifactorial analysis of predictors of outcome in pediatric intracranial ependymoma. Neuro Oncol 2008, 10(5):675–689. 10.1215/15228517-2008-036

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Kumar D, Devaraj H: Expression of Wnt 3a, β-Catenin, Cyclin D1 and PCNA in Mouse Dentate Gyrus Subgranular Zone (SGZ): a Possible Role of Wnt Pathway in SGZ Neural Stem Cell Proliferation. Folia Biol (Praha) 2012, 58: 115–120.

    CAS  Google Scholar 

  55. Zhao X, Liu Z, Yu L, Zhang Y, Baxter P, Voicu H, Gurusiddappa S, Luan J, Su JM, Leung H-cE: Global gene expression profiling confirms the molecular fidelity of primary tumor-based orthotopic xenograft mouse models of medulloblastoma. Neuro Oncol 2012, 14(5):574–583. 10.1093/neuonc/nos061

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Valera ET, Scrideli CA, Queiroz R, Mori B, Tone LG: Multiple drug resistance protein (MDR-1), multidrug resistance-related protein (MRP) and lung resistance protein (LRP) gene expression in childhood acute lymphoblastic leukemia. Sao Paulo Med J 2004, 122(4):166–171. 10.1590/S1516-31802004000400007

    Article  PubMed  Google Scholar 

  57. Pfaffl MW: A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res 2001, 29(9):e45-e45. 10.1093/nar/29.9.e45

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Barrow J, Adamowicz-Brice M, Cartmill M, MacArthur D, Lowe J, Robson K, Brundler M-A, Walker DA, Coyle B, Grundy R: Homozygous loss of ADAM3A revealed by genome-wide analysis of pediatric high-grade glioma and diffuse intrinsic pontine gliomas. Neuro Oncol 2011, 13(2):212–222. 10.1093/neuonc/noq158

    Article  CAS  PubMed  Google Scholar 

  59. Ryan SL, Schwalbe EC, Cole M, Lu Y, Lusher ME, Megahed H, O’Toole K, Nicholson SL, Bognar L, Garami M, Hauser P, Korshunov A, Pfister SM, Williamson D, Taylor RE, Ellison DW, Bailey S, Clifford SC: MYC family amplification and clinical risk-factors interact to predict an extremely poor prognosis in childhood medulloblastoma. Acta Neuropathol 2012, 123(4):501–513. doi:10.1007/s00401–011–0923-y 10.1007/s00401-011-0923-y

    Article  CAS  PubMed  Google Scholar 

  60. Northcott PA, Korshunov A, Witt H, Hielscher T, Eberhart CG, Mack S, Bouffet E, Clifford SC, Hawkins CE, French P: Medulloblastoma comprises four distinct molecular variants. J Clin Oncol 2011, 29(11):1408–1414. 10.1200/JCO.2009.27.4324

    Article  PubMed  Google Scholar 

  61. Remke M, Hielscher T, Korshunov A, Northcott PA, Bender S, Kool M, Westermann F, Benner A, Cin H, Ryzhova M: FSTL5 is a marker of poor prognosis in non-WNT/non-SHH medulloblastoma. J Clin Oncol 2011, 29(29):3852–3861. 10.1200/JCO.2011.36.2798

    Article  CAS  PubMed  Google Scholar 

  62. Pambid MR, Berns R, Adomat HH, Hu K, Triscott J, Maurer N, Zisman N, Ramaswamy V, Hawkins CE, Taylor MD: Overcoming resistance to sonic hedgehog inhibition by targeting p90 ribosomal S6 kinase in pediatric medulloblastoma. Pediatr Blood Cancer 2014, 61(1):107–115. 10.1002/pbc.24675

    Article  CAS  PubMed  Google Scholar 

  63. Moitra K, Lou H, Dean M: Multidrug efflux pumps and cancer stem cells: insights into multidrug resistance and therapeutic development. Basic Clin Pharmacol Toxicol 2011, 89(4):491–502.

    CAS  Google Scholar 

  64. Radice P, Bunn P Jr, Ihde D: Therapeutic trials with VP-16–213 and VM-26: active agents in small cell lung cancer, non-Hodgkin’s lymphomas, and other malignancies. Cancer Treat Rep 1979, 63(8):1231–1239.

    CAS  PubMed  Google Scholar 

  65. Ozols RF, Cunnion RE, Klecker RW Jr, Hamilton TC, Ostchega Y, Parrillo JE, Young RC: Verapamil and adriamycin in the treatment of drug-resistant ovarian cancer patients. J Clin Oncol 1987, 5(4):641–647.

    CAS  PubMed  Google Scholar 

  66. Deibert P, SCHUMACHER YO, Ruecker G, Opitz O, Blum H, Rössle M, Kreisel W: Effect of vardenafil, an inhibitor of phosphodiesterase‒5, on portal haemodynamics in normal and cirrhotic liver–results of a pilot study. Aliment Pharmacol Ther 2006, 23(1):121–128. 10.1111/j.1365-2036.2006.02735.x

    Article  CAS  PubMed  Google Scholar 

  67. Wardle AJ, Tulloh RM: Paediatric pulmonary hypertension and sildenafil: current practice and controversies. Arch Dis Child Educ Pract Ed 2013, 98(4):141–147. doi:10.1136/archdischild-2013–303981 10.1136/archdischild-2013-303981

    Article  CAS  PubMed  Google Scholar 

  68. Hu J, Ljubimova JY, Inoue S, Konda B, Patil R, Ding H, Espinoza A, Wawrowsky KA, Patil C, Ljubimov AV: Phosphodiesterase type 5 inhibitors increase Herceptin transport and treatment efficacy in mouse metastatic brain tumor models. PLoS One 2010, 5(4):e10108. 10.1371/journal.pone.0010108

    Article  PubMed  PubMed Central  Google Scholar 

  69. Ding PR, Tiwari AK, Ohnuma S, Lee JWKK, An X, Dai CL, Lu QS, Singh S, Yang DH, Talele TT: The phosphodiesterase-5 inhibitor vardenafil is a potent inhibitor of ABCB1/P-glycoprotein transporter. PLoS One 2011, 6(4):e19329. 10.1371/journal.pone.0019329

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. Gandhi L, Camidge DR, de Oliveira MR, Bonomi P, Gandara D, Khaira D, Hann CL, McKeegan EM, Litvinovich E, Hemken PM: Phase I study of Navitoclax (ABT-263), a novel Bcl-2 family inhibitor, in patients with small-cell lung cancer and other solid tumors. J Clin Oncol 2011, 29(7):909–916. 10.1200/JCO.2010.31.6208

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  71. Tahir SK, Yang X, Anderson MG, Morgan-Lappe SE, Sarthy AV, Chen J, Warner RB, Ng SC, Fesik SW, Elmore SW: Influence of Bcl-2 family members on the cellular response of small-cell lung cancer cell lines to ABT-737. Cancer Res 2007, 67(3):1176–1183. 10.1158/0008-5472.CAN-06-2203

    Article  CAS  PubMed  Google Scholar 

  72. Certo M, Del Gaizo MV, Nishino M, Wei G, Korsmeyer S, Armstrong SA, Letai A: Mitochondria primed by death signals determine cellular addiction to antiapoptotic BCL-2 family members. Cancer Cell 2006, 9(5):351–365. 10.1016/j.ccr.2006.03.027

    Article  CAS  PubMed  Google Scholar 

  73. Hann CL, Daniel VC, Sugar EA, Dobromilskaya I, Murphy SC, Cope L, Lin X, Hierman JS, Wilburn DL, Watkins DN: Therapeutic efficacy of ABT-737, a selective inhibitor of BCL-2, in small cell lung cancer. Cancer Res 2008, 68(7):2321–2328. 10.1158/0008-5472.CAN-07-5031

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  74. Yecies D, Carlson NE, Deng J, Letai A: Acquired resistance to ABT-737 in lymphoma cells that up-regulate MCL-1 and BFL-1. Blood 2010, 115(16):3304–3313. 10.1182/blood-2009-07-233304

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  75. Vogler M, Butterworth M, Majid A, Walewska RJ, Sun XM, Dyer MJS, Cohen GM: Concurrent up-regulation of BCL-XL and BCL2A1 induces approximately 1000-fold resistance to ABT-737 in chronic lymphocytic leukemia. Blood 2009, 113(18):4403–4413. 10.1182/blood-2008-08-173310

    Article  CAS  PubMed  Google Scholar 

  76. Xu H, Krystal GW: Actinomycin D decreases Mcl-1 expression and acts synergistically with ABT-737 against small cell lung cancer cell lines. Clin Cancer Res 2010, 16(17):4392–4400. 10.1158/1078-0432.CCR-10-0640

    Article  CAS  PubMed  Google Scholar 

  77. Konopleva M, Contractor R, Tsao T, Samudio I, Ruvolo PP, Kitada S, Deng X, Zhai D, Shi Y-X, Sneed T: Mechanisms of apoptosis sensitivity and resistance to the BH3 mimetic ABT-737 in acute myeloid leukemia. Cancer Cell 2006, 10(5):375–388. 10.1016/j.ccr.2006.10.006

    Article  CAS  PubMed  Google Scholar 

  78. van Delft MF, Wei AH, Mason KD, Vandenberg CJ, Chen L, Czabotar PE, Willis SN, Scott CL, Day CL, Cory S: The BH3 mimetic ABT-737 targets selective Bcl-2 proteins and efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized. Cancer Cell 2006, 10(5):389–399. 10.1016/j.ccr.2006.08.027

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  79. Hammond LA, Eckardt JR, Baker SD, Eckhardt SG, Dugan M, Forral K, Reidenberg P, Statkevich P, Weiss GR, Rinaldi DA: Phase I and pharmacokinetic study of temozolomide on a daily-for-5-days schedule in patients with advanced solid malignancies. J Clin Oncol 1999, 17(8):2604–2604.

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank Professor James Lowe for histopathological review of the original patient tumour samples. We thank Dr Anna Grabowska for her helpful comments and discussion. We would also like to thank Pharminox for providing TMZ, Sulfoxide and propargyl and Geminx for obatoclax. This study was supported by the Ministry of Higher Education and Scientific Research/Kurdistan Regional Government/Iraq.

Author information

Authors and Affiliations

  1. Children’s Brain Tumour Research Centre, Division of Child Health, Obstetrics and Gynaecology, School of Medicine, University of Nottingham, QMC, Nottingham, NG7 2UH, UK

    Ramadhan T Othman, Ioanna Kimishi, Lisa CD Storer, Richard G Grundy & Beth Coyle

  2. Centre for Biomolecular Sciences, School of Pharmacy, University of Nottingham, Nottingham, NG7 2UH, UK

    Tracey D Bradshaw

  3. Clinical Cooperation Unit Neuropathology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, Heidelberg, Germany

    Andrey Korshunov

  4. Division of Pediatric Neurooncology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 580, 69120, Heidelberg, Germany

    Stefan M Pfister

  5. School of Life Sciences, University of Nottingham, QMC, Nottingham, NG7 2UH, UK

    Ian D Kerr

Authors
  1. Ramadhan T Othman
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Ioanna Kimishi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Tracey D Bradshaw
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Lisa CD Storer
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Andrey Korshunov
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Stefan M Pfister
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Richard G Grundy
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Ian D Kerr
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Beth Coyle
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Beth Coyle.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

RTO was involved in designing the project, performing the majority of experiments, interpreting and analysing the data, statistical analysis and manuscript preparation. IK performed the BCL2 family experiments, interpreted and analysed this data, carried out the statistical analysis and prepared this data for publication. TDB was involved in conceptualising and interpreting the TMZ data and manuscript preparation. LCDS was involved in supporting IHC experiments, preparing reagents, analysing and interpreting the data. AK was involved in analysing and interpreting the IHC data. SMP was involved in interpreting the data and critically appraising the manuscript. RGG was involved in provision of clinical samples and critically appraising the manuscript. IDK was involved in conceptualising the project, interpreting the data and preparing the manuscript. BC was involved in conceptualising the project, analysing and interpreting the data and preparing the manuscript. All authors read and approved the final manuscript.

Electronic supplementary material

Additional file 1: Table S1: Clinicopathological characteristic of MB patients included in Nottingham TMA. (DOCX 14 KB)

Additional file 2: Table S2: Antibodies used in the IHC analysis. (DOCX 15 KB)

40478_2014_133_MOESM3_ESM.docx

Additional file 3: Table S3: Correlation of ABCB1 expression with clinicopathological characteristics of DKFZ + Nottingham TMA cohorts. (DOCX 15 KB)

40478_2014_133_MOESM4_ESM.doc

Additional file 4: Table S4: Clinical characteristics of the 5 patients from whom 6 new MB cell lines were derive. (DOC 39 KB)

40478_2014_133_MOESM5_ESM.jpeg

Additional file 5: Figure S1: Patterns of MB marker subtype immunostaining on each patient’s original tissue sample. (JPEG 1 MB)

Additional file 6: Figure S2: Molecular sub-classification of the 8 MB cell lines. (PDF 160 KB)

Additional file 7: Figure S3: Elevated MYCC and MYCN copy numbers in MB cell lines. (PDF 323 KB)

Additional file 8: Figure S4: β-catenin (CTNNB1) sequencing in MED5R and MED6 tumours and cell lines. (PDF 32 KB)

Additional file 9: Figure S5: ABCB1 expression in original patient tumours. (JPEG 695 KB)

Additional file 10: Figure S6: MED1 cells show high ABCB1 protein expression. (JPEG 185 KB)

Additional file 11: Figure S7: ABCB1 expression is found in a small subpopulation of cells. (PDF 37 KB)

Additional file 12: Figure S8: MGMT expression in the original patient tumours. (JPEG 768 KB)

Additional file 13: Figure S9: Chemosensitization of TMZ and propargyl by rucaparib in MB cell lines. (PDF 133 KB)

Authors’ original submitted files for images

Rights and permissions

Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Othman, R.T., Kimishi, I., Bradshaw, T.D. et al. Overcoming multiple drug resistance mechanisms in medulloblastoma. acta neuropathol commun 2, 57 (2014). https://doi.org/10.1186/2051-5960-2-57

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/2051-5960-2-57

Keywords

Acta Neuropathologica Communications

ISSN: 2051-5960

Contact us